Is baptism for the dead really Christian?

The upper-crust forum for scholarly, polite, and respectful discussions only. Heavily moderated. Rated G.
_subgenius
_Emeritus
Posts: 13326
Joined: Thu Sep 01, 2011 12:50 pm

Re: Is baptism for the dead really Christian?

Post by _subgenius »

Melchett wrote:I'm puzzled. What is the difference between documentation and not having a specific record of a name? Surely, you need a name to carry out the baptism?

let us take the remains of a woman found in 1997 in the Wolf's den cave
Surely we can agree that she lay about "unknown" and "undocumented" for about 1900 years. We do not know the name she was called when she was alive nor do we know who her parents were...or if she had children. But does leave her without identity... is it her name that makes her a "someone"? Does not the fact that she has been discovered give her an singular identity...i mean we are not confusing her with anyone else...she is a singular human being. If we name her for the sake of reference, then undoubtedly she still remains herself....is not a rose still a rose?

Melchett wrote:I'll point at my Irish ancestors. My great-great-great-grandfather. He is completely unknown.

his name completely unknown to you at this point in time, agreed....but by your presence, we know that such an individual existed....correct? i mean surely we can assume, by the evidence of your existence, that there was indeed a great-great-great-grandfather. Even if, for now, we just call him great-great-great-grandpa Melchett.

Melchett wrote:I would like to know your evidence to the contrary of your assumption.

i asked you first ( which we can now add to the list of questions you seemingly refuse to address).
First one has to prove that there is actually someone, who existed, that is unable to be proven that they ever existed.......hmmmm, can you do that?
Seek freedom and become captive of your desires...seek discipline and find your liberty
I can tell if a person is judgmental just by looking at them
what is chaos to the fly is normal to the spider - morticia addams
If you're not upsetting idiots, you might be an idiot. - Ted Nugent
_subgenius
_Emeritus
Posts: 13326
Joined: Thu Sep 01, 2011 12:50 pm

Re: Is baptism for the dead really Christian?

Post by _subgenius »

Franktalk wrote:Psa 147:4 He telleth the number of the stars; he calleth them all by their names.

I wonder why it is that we ask these questions. If called upon to do Baptisms for the dead then we should do all we can and then we need God's help He will surely help. Should we go forth in faith that what we do on earth will have an impact on the spiritual world?

Let me ask a question. Just what is being Baptized, the body or the spirit? If the spirit which is eternal then a proxy Baptism makes perfect sense.

Image
Seek freedom and become captive of your desires...seek discipline and find your liberty
I can tell if a person is judgmental just by looking at them
what is chaos to the fly is normal to the spider - morticia addams
If you're not upsetting idiots, you might be an idiot. - Ted Nugent
_canpakes
_Emeritus
Posts: 8541
Joined: Wed Dec 07, 2011 6:54 am

Re: Is baptism for the dead really Christian?

Post by _canpakes »

Franktalk wrote:Psa 147:4 He telleth the number of the stars; he calleth them all by their names.


Like this one, also -

Isaiah 40:26 : "Lift up your eyes on high, and behold who hath created these things, that bringeth out their host by numbers; he calleth them all by names, by the greatness of his might, for that he is strong in power; not one faileth."

Who is it that can do this? Man or Heavenly Father?


I wonder why it is that we ask these questions. If called upon to do Baptisms for the dead then we should do all we can and then we need God's help He will surely help. Should we go forth in faith that what we do on earth will have an impact on the spiritual world?

Let me ask a question. Just what is being Baptized, the body or the spirit? If the spirit which is eternal then a proxy Baptism makes perfect sense.



Good question. Similarly, if we are baptising someone who has moved beyond 'the body', then is a proxy baptism with a body necessary? Or if so, why would we need to personally identify someone by name as opposed to merely identifying them by position along our family tree? Or what would prevent a person from baptising relatives en masse considering that the process of baptising oneself (one body) while alive is fundamentally different than extending a baptism through a proxy to others who have died and are 'spirit only'?

Why do folks ask these questions? In my case, primarily because there seems to be confusion in the revelation and I've been told that not everything J. Smith stated was to be taken as revelation. Matched against the modern-day interpretation that baptisms for the dead are fundamentally essential, the contrast begs to be explored.
_Melchett
_Emeritus
Posts: 173
Joined: Wed Dec 07, 2011 2:05 pm

Re: Is baptism for the dead really Christian?

Post by _Melchett »

subgenius wrote:let us take the remains of a woman found in 1997 in the Wolf's den cave
Surely we can agree that she lay about "unknown" and "undocumented" for about 1900 years. We do not know the name she was called when she was alive nor do we know who her parents were...or if she had children. But does leave her without identity... is it her name that makes her a "someone"? Does not the fact that she has been discovered give her an singular identity...i mean we are not confusing her with anyone else...she is a singular human being. If we name her for the sake of reference, then undoubtedly she still remains herself....is not a rose still a rose?


Yes, she is still unknown. How do you baptise her? How does she get the call in the celestial waiting room?

subgenius wrote:his name completely unknown to you at this point in time, agreed....but by your presence, we know that such an individual existed....correct? i mean surely we can assume, by the evidence of your existence, that there was indeed a great-great-great-grandfather. Even if, for now, we just call him great-great-great-grandpa Melchett.


Really? This is actually logical? Do I really know I had a great-great-great grandfather? perhaps I had a great-great grandfather that lived a very long time. Can you prove otherwise? If he did exist, once again, how does he get the page in the celestial waiting room?

subgenius wrote:i asked you first ( which we can now add to the list of questions you seemingly refuse to address).
First one has to prove that there is actually someone, who existed, that is unable to be proven that they ever existed.......hmmmm, can you do that?


Where the hell did you come up with that question? Prove to you someone that existed didn't?

Really?

Still, I will give it ago. Major William Martin of the Royal Marines. Born March 29 1907 and died April 24 1943.


Please give me a list of questions I haven't answered, and I'll do my best.
_Melchett
_Emeritus
Posts: 173
Joined: Wed Dec 07, 2011 2:05 pm

Re: Is baptism for the dead really Christian?

Post by _Melchett »

subgenius wrote:
Melchett wrote:I would like to know your evidence to the contrary of your assumption.

i asked you first ( which we can now add to the list of questions you seemingly refuse to address).
First one has to prove that there is actually someone, who existed, that is unable to be proven that they ever existed.......hmmmm, can you do that?

Highlighting mine.

I've just looked over this thread, and can't see a list of questions that I have refused to answer, in fact, I seem to have answered all. I see questions of mine you haven't answered.

Please show me this 'list' of things I have refused to address.
_Melchett
_Emeritus
Posts: 173
Joined: Wed Dec 07, 2011 2:05 pm

Re: Is baptism for the dead really Christian?

Post by _Melchett »

Bumped for answer.
_keithb
_Emeritus
Posts: 607
Joined: Mon Jan 17, 2011 4:09 am

Re: Is baptism for the dead really Christian?

Post by _keithb »

Aristotle Smith wrote:
Corpsegrinder wrote:Sorry, friend. Out here in the real world, qualifiers most certainly are allowed.


OK then, you go with option #2, "Mormons are Christian heretics, Mormons practice baptism for the dead, therefore Christian heretics practice baptism for the dead." My point was (which you obviously didn't grok) was either you allow for qualifiers or you don't. So if you want to add qualifiers to what types of Mormons practice polygamy and how they practice it, then the Christian is allowed to do the same and qualify what kind of Christian practices baptism for the dead. You don't get to play "heads I win, tails you lose."

Corpsegrinder wrote:So tell me, how is this not an exercise in "my-mythology-is-better-than-your-mythology"?


When one thinks one of the options is not mythology. If you really think both Christianity and Mormonism are obviously mythological, why are you wasting your time with all of this?


Who gets to decide who is heretical? Maybe your sect of Christianity is the heretical one.
"Joseph Smith was called as a prophet, dumb-dumb-dumb-dumb-dumb" -South Park
_keithb
_Emeritus
Posts: 607
Joined: Mon Jan 17, 2011 4:09 am

Re: Is baptism for the dead really Christian?

Post by _keithb »

subgenius wrote:
Melchett wrote:What about ancestors from Europe, let's say 13th Century. Where would you go to get the documents of these individuals so that these people can be baptized?

well, i no longer subscribe to ancestry.com, but that is one potential source, especially since i have lineage already traced back across the pond...another is to actually travel to Birchfield England and reference their records, etc..
interestingly enough i knew a fellow whose only mention of a distant relative was in a court journal, it was an obscure reference about an incident where a Spanish (Moorish) soldier had shot this relative with an arrow. Time period was about 750ad. or some such time.
Point being, with diaries, official records, and other various archaeological evidences, it is likely that one could "document" most people that have "been" since this particular ordinance came into effect.

now, i believe it was your turn


How would your document your hominid ancestors from 25,000 B.C.E. ? Do the records at ancestry.com go back that far?
"Joseph Smith was called as a prophet, dumb-dumb-dumb-dumb-dumb" -South Park
_keithb
_Emeritus
Posts: 607
Joined: Mon Jan 17, 2011 4:09 am

Re: Is baptism for the dead really Christian?

Post by _keithb »

Perhaps we're looking at this the wrong way. Perhaps the way to look at this is through genetically tracing our ancestors through mitochondrial DNA. In that case, will the millennium look something like this:

"I baptize you for and in behalf of:

ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG
TTTAATTACAGACCTGAA .....


.... ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG
TTTAATTACAGACCTGAA

who is dead, in the name of the Father, and of the Son, and of the Holy Ghost, amen"?
"Joseph Smith was called as a prophet, dumb-dumb-dumb-dumb-dumb" -South Park
_Melchett
_Emeritus
Posts: 173
Joined: Wed Dec 07, 2011 2:05 pm

Re: Is baptism for the dead really Christian?

Post by _Melchett »

Still waiting for a list of questions that I have stubbornly refused to answer, and, quite possibly, receive answers to mine.
Post Reply